Bioinformatique pour les nuls

Bioinformatique réunit les technologies de l'information et de la biologie moléculaire, il est donc logique que l'Internet est l'arène principale pour la poursuite de l'information de la bioinformatique. La liste suivante propose des liens vers des sites Web utiles à travers le monde et les zones qu'ils se spécialisent dans:

Sommaire

  • Ensembl: Le génome humain

  • GenBank / DDBJ / EMBL: séquence nucléotidique

  • PubMed: références de la littérature

  • Swiss Institute of Bioinformatics: séquences de protéines annotées

  • InterProScan: Les domaines protéiques

  • OMIM: maladies génétiques

  • GenomeNet: voies métaboliques

Bioinformatique Sites Web pour analyse de l'ADN / ARN de séquences

Les sites de bioinformatique Web dans la liste ci-dessous offre de l'aide dans l'analyse de séquences d'ADN et d'ARN. Et, dans le mariage de la technologie de l'information et de la biologie moléculaire qui est la bio-informatique, ce type d'analyse est ce qu'elle est tout au sujet.

  • Webcutter: Carte de restriction

  • GenomeScan: Gene découverte

  • blastn, tblastn, blastx: recherche de base de données

  • Le navigateur de Génome: parcourir les données ultimes!

  • Mfold: prédiction de la structure de l'ARN

Bioinformatique Sites Web pour analyse de séquences protéiques

Avec la bioinformatique, vous pourrez explorer la biologie moléculaire en utilisant la technologie de l'information. Les liens vers les sites Web dans la liste ci-dessous accent sur des séquences de protéines. Certains offrent bases de données interrogeables, d'autres vous aider à enquêter sur une seule protéino tous sont utiles:

  • Recherche d'homologie Base de données: BLAST

  • SRS: recherche de base de données


  • Entrez: recherche de base de données

  • InterProScan: Trouvez domaines protéiques

  • ExPASy: Analyser une protéine

  • Alignement de séquence multiple: ClustalW

  • T-Coffee: Évaluer alignement multiple

  • Jalview: Multiple éditeur d'alignement

  • PSIPRED: prédiction de structure secondaire

  • Cn3D: affichage et de spin structures 3-D

Formats de données bioinformatiques

Lorsque vous utilisez l'Internet pour aider avec votre projet de bioinformatique, vous tombez sur des données dans toutes sortes de formats différents. Le tableau suivant peut vous aider à comprendre formats bioinformatiques communes et ce que vous pouvez et ne pouvez pas faire avec eux.

Format NomDescription
BRUTFormat de séquence qui ne contient pas d'en-tête. Espaces andnumbers sont généralement tolérées.
FASTACeci est le format par défaut. Format de séquence qui contient aheader ligne et la séquence: > nom
AGCTGTGTGGGTTGGTGGGTT
PIRFormat de séquence qui est similaire à FASTA mais moins commun
MSFFormat d'alignement de séquences multiples
CLUSTALFormat alignement de séquences multiples (fonctionne avec T-café)
SMSFormat texte
GIF, JPEG, PNG, PDFFormats graphiques. Ne pas les utiliser pour stocker INFORMATIONSIMPORTANT.

» » » » Bioinformatique pour les nuls